Skip to main content

Table 2 Primer sequences of nested PCR

From: Establishment of a loop-mediated isothermal amplification (LAMP) assay for the detection of phytoplasma-associated cassava witches’ broom disease

  Primers Sequences
Round 1 P1A ACGCTGGCGGCGCGCCTTAATAC
P7A CCTTCATCGGCTCTTAGTGC
Round 2 R16F2n GAAACGACTGCTAAGACTGG
R16R2 TGACGGGCGGTGTGTACAAACCCCG
Round 3 R16(I)F1 TAAAAGACCTAGCAATAGG
R16(I)R1 CAATCCGAACTGAGAATGT