Table 1 Plasmids, Escherichia coli strains, and primers used in this study
Plasmids or E. coli strain or primers | Relevant properties or genetic marker | Source or reference | |
|---|---|---|---|
Plasmids | |||
pACYCDDuet | P15A ori, Cmr | Novagen | |
pCDFDuet | CloDE13 ori, Strr | Novagen | |
pA-SeTAL | pACYCDuet carrying TAL from Saccharothrix espanaensis | Kim et al. 2013 | |
pC-SeTAL | pCDFDuet carrying TAL from Saccharothrix espanaensis | ||
pA-AtPAL | pACYCDuet carrying PAL from Arabidopsis thaliana | ||
pC-Sam5 | pCDFDuet carrying monooxygenase (Sam5) from Saccharothrix espanaensis | Lee et al. 2014 | |
pC-Sam5-ROMT5 | pCDFDuet carrying monooxygenase (Sam5) from Saccharothrix espanaensis and O-methyltransferase (ROMT9) from Oryza sativa | ||
pA-aroG-SeTAL-tyrA | pACYCDuet carrying SeTAL, aroG, and tyrA | Kim et al. 2013 | |
pA-aroGfbr-SeTAL-tyrAfbr | pACYCDuet carrying SeTAL and feedback inhibition free of aroG and tyrA | Kim et al. 2013 | |
Strains | |||
BL21 (DE3) | F− ompT hsdS B (r −B m −B ) gal dcm lon (DE3) | ||
B-T | BL21(DE3) FRT-ΔtyrR::FRT-kan R-FRT | Kim et al. 2013 | |
B-TP | BL21(DE3) ΔtyrR::FRT- ΔPheA::FRT-kan R-FRT | Kim et al. 2013 | |
B-TT | BL21(DE3) ΔtyrR::FRT- ΔTyrA::FRT-kan R-FRT | Kim et al. 2013 | |
B-pCA1 | BL21 (DE3) in which SeTAL was integrating into tyrR of E. coli | This study | |
B-pCA2 | B-T harboring pA-SeTAL | This study | |
B-pCA3 | B-T harboring pC-SeTAL | This study | |
B-pCA4 | B-TP harboring pA-SeTAL | This study | |
B-pCA5 | B-TP harboring pA-aorG-SeTAL-TyrA | This study | |
B-pCA6 | B-TP harboring pA-aorGfbr-SeTAL-TyrAfbr | This study | |
B-CA1 | B-TP harboring pA-aorGfbr-SeTAL-TyrAfbr and pC-Sam5 | This study | |
B-FA1 | B-TP harboring pA-aorGfbr-SeTAL-TyrAfbr and pC-Sam5-ROMT5 | This study | |
B-CiA1 | BL21 (DE3) harboring pA-AtPAL | This study | |
B-CiA2 | B-T harboring pA-AtPAL | This study | |
B-CiA3 | B-TT harboring pA-AtPAL | This study | |
Primers | Sequence (5′ → 3′) | ||
SeTAL-F | ATgaattcGATGACGCAGGTCGTGGAACGT | ||
SeTAL-R | CATAAGCTTTCATCCGAAATCCTTCCCGTC | ||
TyrR-del-F | GTTGACAGAAACCTTCCTGCTATCCAAATAGTGTCATATCATCATATTAATTGTTCTTTTTTCAGGTGAAGGTTCCCATGgctatcatgccataccgcga | ||
TyrR-del-R | TGAAAGCATAATTTAATATGCCTGATGGTGTTGCACCATCAGGCATATTCGCGCTTACTCTTCGTTCTTCTTCTGACTCAccgtgtgcttctcaaatgcc | ||