- Article
- Open access
- Published:
Molecular characterization of HEXOKINASE1 in plant innate immunity
Applied Biological Chemistry volume 63, Article number: 76 (2020)
Abstract
Hexokinase1 (HXK1) is an Arabidopsis glucose sensor that has a variety of roles during plant growth and devlopment, including during germination, flowering, and senescence. HXK1 also acts as a positive regulator of plant immune responses. Previous research suggested that HXK1 might influence plant immune responses via responses to glucose. Plant immune responses are governed by two main pathways: PAMP-triggered immunity (PTI) and effector-triggered immunity (ETI). PTI involves the recognition of Pathogen-Associated Molecular Patterns (PAMPs) and leads to increased callose formation and accumulation of pathogenesis response (PR) proteins. ETI acts in response to effectors secreted by Gram-negative bacteria. During ETI, the membrane-localized protein RPM1-interacting protein 4 (RIN4) becomes phosphorylated in reponse to interactions with effectors and mediates the downstream response. In this study, the effects of glucose on plant immune responses against infection with Pseudomonas syringae pv. tomato DC3000 and other P. syringae strains were investigated in the presence and absence of HXK1. Infiltration of leaves with glucose prior to infection led to decreases in bacterial populations and reductions in disease symptoms in wild-type Arabidopsis plants, indicating that glucose plays a role in plant immunity. Both PTI and ETI responses were affected. However, these effects were not observed in a hxk1 mutant, indicating that the effects of glucose on plant immune responses were mediated by HXK1-related pathways.
Introduction
Sugar metabolism in plants is a critical and complex process that involves glycolysis, the tricarboxylic acid (TCA) cycle, and pentose phosphate pathways. Hexokinases (HXK) play key roles in sugar metabolism through phosphorylation of glucose to glucose-6-phosphate. The HXK family contains six members: HXK1, HXK2, HXK3, HKL1, HKL2, and HKL3 [1]. HXK1 is a multifunctional protein that is involved in sugar metabolism and signalling. An Arabidopsis hxk1 mutant exhibited delayed flowering and senescence as well as smaller leaves and root systems [2]. HXK1 was shown to affect the concentration of glucose in seedlings, and the absence of HXK1 significantly suppressed the effects of glucose [3].
Another HXK family member, HXK2, is involved in plant immunity. Overexpression of HXK2 led to enhanced plant resistance to pathogens and was correlated with elevated H2O2 production and expression of defensive genes [4]. HXK1 and HXK2 share similar features: both proteins have several functions, one of which is sugar-sensing in Arabidopsis [5].
Plants activate their innate immune systems via two pathways [6]. The first line of activation is PAMP-triggered immunity (PTI), which involves the recognition of Pathogen-Associated Molecular Patterns (PAMPs) by membrane-localized Pattern Recognition Receptors (PRRs) [7]. In the very early stages of the PTI response (within 1–5 min), PAMPs such as flagellin and EF-Tu are activated by PRRs, namely FLS2 and EFR [8, 9], after which the FLS-BAK1 complex forms within 2 min [10, 11]. Ion fluxes, oxidative bursts, and protein phosphorylation also occur during this stage. In the next stage of the response (5–30 min), PTI induces ethylene biosynthesis, receptor endocytosis, and gene activation. These early responses lead to callose deposition and seedling growth inhibition over a longer timescale (hours-days) [12]. Subsequently, the accumulation of PR proteins instigates Systemic Acquired Resistance (SAR), which expands the local immune response of the plant to act against a broad spectrum of pathogens [13].
Effector triggered immunity (ETI) is the second line of activation of the plant immune system [6]. ETI acts in response to effector proteins secreted by the type III secretion system (TTSS) in Gram-negative plant-pathogenic bacteria [14]. Receptor (R) proteins which contain both Nucleotide-Binding (NB) and Leucine-Rich Repeat (LRR) domains can be triggered by direct interactions with their corresponding avirulence (Avr) effectors [15, 16] or indirectly via detection of the action of an Avr effector on its target [17, 18].
The hypersensitive response (HR), a type of plant resistance response, induces programmed cell death at infection sites and inhibits pathogen growth [19]. Arabidopsis protein RIN4 is a well-characterized component of this type of resistance response, and can be explained by the guard hypothesis [6]. RIN4 is a small protein that localizes to the plasma membrane alongside several guard proteins, including RPM1 (resistance to P. syringae pv. maculicola 1) and RPS2 (resistance to P. syringae 2) [20, 21]. Bacterial type III effector protein AvrRpm1 acts via RIPK and related kinases to mediate phosphorylation of RIN4 and thereby activate RPM1 [22]. AvrRpt2 is a cysteine protease which cleaves RIN4 at two sites, producing three fragments of 15.9Â kDa, 6.4Â kDa, and 1.2Â kDa [23]. Degradation of RIN4 activates RPS2 and may induce a conformational change in the RPS2-RIN4 complex [24].
The relationship between sugars such as glucose and innate plant immunities remain poorly understood. In this study, the effects of glucose on plant immunity in the presence and absence of HXK1 were assessed, and links to PTI and ETI mechanisms were elucidated.
Materials and methods
Plant lines and growth conditions
Arabidopsis thaliana accessions Columbia (Col-0) and Landsberg erecta (Ler) and HXK1 deficient mutant hxk1 (SALK _034233) (in both the Col-0 and Ler backgrounds) were a kind gift from professor Woe Yeon Kim at the Division of Applied Life Science, Gyeongsang National University, Republic of Korea. Plants were cultivated in a growth chamber with a 16 h light / 8 h dark light cycle, light intensity 75 µmol m−2 s−1, humidity 85 ± 1%, and temperature 22 ± 1 °C. After 2 weeks, seedlings were transferred to a large tray and cultivated until seedlings were 4–5 weeks old. All seedlings were grown following long days (16 h light/8 h dark) to determine the protein accumulation and gene expression levels.
Bacterial strains and treatment
Pseudomonas syringae pv. tomato DC3000 containing an empty vector plasmid pVSP61(Pto), type III effector protein-expressing strains Pto AvrRpm1 and Pto AvrRpt2, Pto TTSS-deficient mutant hrcC−, and P.syringae pv. Phaseolicola (Pph) were provided by Professor David Mackey’s Lab, Ohio State University U.S.A. Bacterial strains were grown at 27 °C for 2 days in King’s broth medium containing appropriate antibiotics. WT and hxk1 plants were evenly assigned into either the Mock group infiltrate with water 24 h before inoculating with 10 mM MgSO2), the Mock + bacteria (Pto, P.syringae pv. Phaseolicola (Pph) or Pto AvrRpm1 and Pto AvrRpt2) infiltrate with water 24 h before inoculating bacteria, or the glu + bacteria group inoculated with 2.5% glucose 24 before inoculating with bacteria. Growth and symptom analysis of Pto DC3000 were conducted as described in [25]. Bacterial solutions were syringe inoculated into 4 to 5 weeks old leaves. Leaf, discs were ground to homogeneity in 10 mM MgCl2 for all growth experiments, and the titer determined by serial dilution and plating.
Callose staining
Four-week-old leaves were syringe-infiltrated with 100 μM flg22 and distilled water or pretreated with water or glucose 24 h before inoculating with flg22 or water as a control and collected after 16 h and stained with methyl blue followed [25], and mounted in 50% glycerol, and examined by fluorescence microscopy (OPTICA, Ponteranica BG Italy). Representative views of these pictures were randomized.
Western analysis
Western blot was executed as previously mentioned with little modification [26]. Approximately 100 µg plant tissue was extracted by mixing with 100 µl protein extraction buffer (100 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 5 mM DTT, and plant protease inhibitor cocktail) and centrifuging at 13,000 rpm for 10 min at 4 °C. Proteins were quantified by bicinchoninic acid assay. Proteins were separated on a 12% SDS-PAGE gel (Mini-protein, Bio-Rad) and transferred to polyvinylidenefluoride membrane. Anti-PR-1 sera were used at a 1:2000 dilution. Chemiluminescent detection and band quantification were performed using a ChemiDoc XRS system (Bio-Rad).
RNA analysis
Total RNA was extracted from approximately 100 µg plant tissue using an RNA extraction kit (QIAGEN), after which RNA was treated with DNaseI. RNA was quantified using a Nanodrop spectrophotometer (DeNovix). Total RNA (approximately 1 µg) was used for cDNA synthesis (ENZYMOMICS). Real-time PCR was performed using a Bio-Rad Real-Time PCR detection system with SYBR Green Super Mix (Cosmo Genetech). Ribosomal protein was used as a control. The following primers were used: FRK1, TCAGAGATCGCTCTTGCTTGTA and CTGTAAGCATTTTCGTCGAGTC; WRKY29, AAGGATCTCCATACCCAAGGA and TTATGGTGAATTTCTCCGGG; Ribosomal protein, CGGACAATTTGGATTCGTTG and ACCACCACCGGAGTATCTCG. Three biological and two technical replications were conducted.
Ion leakage and HR assay
For the ion leakage measurement as previously described [18], 12 leaf discs were collected immediately after inoculation with 2 × 108 CFU/ml bacterial strains Pto expressing AvrRpm1 and AvrRpt2 and washed with 50 ml of ddH2O, after 30 min leaf discs were re-suspended into 10 ml ddH2O. Ion leakage was assessed at different time points. For HR assay WT and hxk1 plants were pretreated with water as a control and 2.5% glucose 24 h before inoculating with 2 × 108 CFU/ml bacterial strains Pto expressing AvrRpm1 and AvrRpt2 and 10 mM MgCl2 as control.
Results
HXK1 positively enhances plant defenses against pathogen infection
To investigate the role of HXK1 in PTI and ETI, the plant immunity-related functions of HXK1 were evaluated using HXK1 deficient mutants (hxk1) generated in the Arabidopsis Col-0 and Ler backgrounds. Five-week-old plants were inoculated with Pseudomonas syringae pv. tomato DC3000 (Pto). Typical disease symptoms appeared in inoculated leaves 4 days after inoculation [27]. Both hxk1 mutants exhibited more severe disease symptoms than the corresponding wild-type (WT) plants (Fig. 1a, c). Bacterial populations in the infected hxk1 mutants were higher than in WT, consistent with the observed infection phenotype (Fig. 1b, d). These results indicate that HXK1 might play an important role in plant defense, and that absence of HXK1 might negatively affect plant immunity to bacteria, resulting in more severe disease symptoms.
HXK1 positively enhances plant defences against P. syringae pv. tomato DC3000 infection. a, c Leaves of WT and hxk1 seedlings (Col-0 and Ler background) after infection with P. syringae pv. tomato DC3000 (Pto) at 2 × 105 CFU/ml concentration or MgCl2 (control). b, d. Bacterial levels in hxk1 and WT plants after infections as (a, c). Error bars represent the standard error of the mean (n = 3). Asterisks indicate significant differences (P < 0.05, Student’s t-test). All experiments were performed three time
HXK1 plays a central role in PAMP-triggered immunity
Previous research showed that expression of FRK1 and WRKY29, two PAMP-response marker genes, was induced by flg22 [28]. To investigate the role of HXK1 in PTI, thus, we found that flg22 was treated in hxk1 mutant plants and wild type. Lower amounts of FRK1 and WRKY29 transcripts accumulated in a hxk1 mutant line than in WT (Fig. 2a, b). These results suggest that HXK1 is required for flg22-induced gene expression. Similarly, when hxk1 mutant plants were infected with the non-pathogenic P. syringae hrcC− mutant, which lacked a functional type III secretion apparatus, bacterial accumulation was higher in hxk1 mutant plants compared to WT (Fig. 2c), indicating a positive role for HXK1 in PTI. Callose formation in plants is a defensive response that involves the deposition of polysaccharides to reduce the number of microorganisms that can enter the plant cell [29, 30]. Flg22-induced callose deposition was significantly reduced in hxk1 mutants compared to WT (Fig. 2d).
HXK1 is involved in PTI. a, b Expression of WRKY29 and FRK1 mRNA in hxk1 mutant and WT Arabidopsis infiltrated with flg22. c Bacterial accumulation in Col-0 and hxk1 after inoculation with 2 × 105 CFU/ml of non-pathogenic P. syringae hrcC−. Error bars represent the standard error of the mean (n = 3). The asterisk indicates a statistically significant difference (P < 0.05, Student’s t-test) (a–c). d Callose deposition in Col-0 and hxk1. e PR1 accumulation in Col-0 and hxk1 after inoculation with of 2 × 106 CFU/ml Pph. Coomassie Brilliant Blue (CBB) staining was used to ensure equivalent loading. hpi  hours post infection. Similar results were obtained in three independent experiments
PR1 can be used as a marker for PTI due to its role in blocking β-1,3glucanase accumulation [31]. PR1 is expressed by P. syringae pv. phaseolicola (Pto Pph), a non-host pathogen [32]. PR1 expression by Pph was reduced in hxk1 mutants compared to Col-0 (Fig. 2e), suggesting that the absence of HXK1 reduced susceptibility to bacteria in Arabidopsis through reductions in callose deposition and PR1 accumulation.
HXK1 partly enhances plant immunity through effector-triggered immunity
Two different effectors were used to assess the role of HXK1 in effector-triggered immunity: avirulent P.syringae strains Pto AvrRpm1 and Pto AvrRpm2. RPM1 is a resistance protein that recognizes phosphorylated RIN4, leading to the hypersensitive response. RIN4 becomes phosphorylated in response to infiltration of Pto AvrRpm1. Infiltration of Pto AvrRpm2 leads to degradation of RIN4, which is recognized by another plant resistance protein, RPS2, leading to HR [26, 33].
In bacterial growth assays, Pto AvrRpm1 proliferation was higher in the hxk1 mutant than in WT (Fig. 3a), suggesting that a lack of HXK1 impaired the response to bacterial infection in Arabidopsis. However, no significant differences were found in Pto AvrRpt2 proliferation between hxk1 and WT (Additional file 1: Fig. S1a). Inoculation with Pto AvrRpm1 stimulated HR in WT at approximately 5 h-post-infection (hpi), but this response was delayed in the hxk1 mutant (Fig. 3b). HR was observed at approximately 9 hpi in both hxk1 and WT leaves inoculated with Pto AvrRpt2 (Additional file 1: Fig. S1b). Ion leakage from plant cells is characteristic of HR-mediated cell death, and an ion leakage assay was therefore used to assess cell death. A faster, more severe cell death response reduces the numbers of bacteria that can spread to neighboring plants tissues. As expected from the results of the HR assay, ion leakage was reduced in hxk1 compared with WT after Pto AvrRpm1 infiltration (Fig. 3c), supporting the hypothesis that HXK1 is important for a rapid ETI response to occur. Taken together, our results indicate that HXK1 positively enhances plant defense against P. syringae pv tomato DC3000 infection through its involvement in PTI and its partial involvement in ETI.
HXK1 is required for RPM1-dependent suppression of Pto AvrRpm1. a Bacterial accumulation in Col-0 and hxk1 after inoculation with 2 × 105 CFU/ml of Pto AvrRpm1. Error bars represent the standard error of the mean (n = 3). The asterisk indicates a statistically significant difference (P < 0.05, Student’s t-test). b Ion leakage assay in hxk1 and WT leaves infiltrated with Pto AvrRpm1 or MgCl2 (control). c Speed of HR in hxk1 and WT infiltrated with Pto AvrRpm1 or MgCl2 (control). Three independent experiments were conducted.
Exogenous glucose positively enhances plant immunity
Sugars have multiple functions in plants. As well as its involvement in carbohydrate biosynthesis during photosynthesis and its role in respiration, previous research showed that low concentrations of glucose positively regulated root growth and development in Arabidopsis seedlings [34]. To investigate the role of glucose in plant immunity, different concentrations of glucose was infiltrated into the leaves of mature 5-week-old Arabidopsis plants. Shortly after infiltration, plants showed an HR-like reaction due to the osmotic pressure resulting from the addition of glucose. At lower glucose concentrations, the plants assimilated the exogenous glucose over the following 24Â h, releasing the osmotic stress and allowing leaves to return to a normal non-HR state. High concentrations of glucose (5% and above) caused permanent damage to plants (Additional file 1: Fig. S2a). Tolerance to glucose was higher in mature plants than in seedlings, where infiltration with 1.5% or 3% glucose was sufficient to suppress seedling growth (Additional file 1: Fig. S2b) [2]. The direct damage caused to cells as a result of the osmotic stress imposed by high concentrations of glucose was irreversible.
Plant defense is not a unilateral process, but involves bilateral interactions between plants and pathogens. To investigate the effects of glucose on bacteria, Pto, Pto AvrRpm1, and Pto AvrRpt2 were cultivated in liquid KB medium containing a range of glucose concentrations. Bacterial populations were assessed at various time points after exogenous glucose treatment, and the bacterial growth was impacted at approximately 16Â h after treatment (Additional file 1: Fig. S3). After confirming that exogenous glucose suppressed bacterial growth in- vitro, similar experiments were performed to understand the effects of glucose on plant growth.
To assess the effects of bacteria on plants in the presence of glucose, low concentrations of glucose were pre-infiltrated into plants leaves followed by infiltration with Pto after 1 day. Disease symptoms (Fig. 4a) and bacterial growth (Fig. 4b) were reduced in the presence of glucose. These results suggest that plant immunity was enhanced by glucose, and that pre-infiltration with glucose may prime the immune response by activating pathways that allow the plant to react more rapidly and more vigorously to pathogen challenge. Howerver, the glucose benefit was lost in the hxk1 mutant both with respect to disease symptoms (Fig. 4c) and bacterial growth (Fig. 4d). This suggests that the role of glucose in plant immunity is linked to the HXK1 pathway, but the specific pathways involved remain unknown.
Exogenous glucose positively enhances plant immunity against Pto. a, c Disease symptoms in Col-0 and hxk1 leaves infiltrated with H2O or 2.5% glucose, followed 1 day later by infiltration with Pto (2 × 106 CFU/ml) or MgCl2 (control). b, d Bacterial growth in leaves infiltrated as described in (a, c). Error bars represent the standard error of the mean (n = 3). The asterisk indicates a statistically significant difference (P < 0.05, Student’s t-test). All experiments were conducted three time
Glucose positively regulates PAMP-triggered immunity via the HXK1 pathway
Callose deposition was examined in infiltrated WT leaves to assess the effects of glucose on PTI (Fig. 5a). Glucose induced higher levels of callose deposition and production of thicker plant cell walls compared to untreated controls. Thinner plant cell walls are more conducive to bacterial entry. Additional callose deposition was not observed in the hxk1 mutant after treatment with exogenous glucose (Fig. 5b). PR1 accumulation is indicative of the speed and intensity of the PTI response. PR1 accumulation was increased and was more rapid in glucose-treated WT plants than in control plants (Fig. 5c), but no similar effect was seen in the hxk1 mutant (Fig. 5d). Taken together, these results indicate that glucose positively regulates PTI via a HXK1-related pathway.
Exogenous glucose positively enhances PTI. a Callose deposition in Col-0 leaves infiltrated with water or glucose (glc) 24Â h before inoculating with 100Â uM flg22. b Callose deposition in hxk1 leaves as described in (a). c PR1 accumulation in Col-0 leaves infiltrated with glucose. d PR1 accumulation in hxk1 leaves infiltrated with glucose. Coomassie Brilliant Blue (CBB) staining was used to ensure equivalent loading. Experiments were repeated three times
HXK1 plays a key role in glucose up-regulation of effector-triggered immunity
Effector proteins from Pto AvrRpm1 and Pto AvrRpt2 were used to assess the effects of glucose on ETI. As with PTI, pre-infiltration of glucose prior to bacterial infiltration successfully reduced bacterial growth in WT Arabidopsis exposed to Pto AvrRpm1 or Pto AvrRpt2 (Fig. 6a), but no reductions in bacterial growth or disease symptoms were seen in the hxk1 mutant (Fig. 6b). This suggests that glucose activates RIN4-related pathways that enhance plant immunity through ETI. A hypersensitive response assay was performed to further elucidate the function of glucose in ETI. In Col-0, HR was observed soon after Pto AvrRpm1 and Pto AvrRpt2 infiltration following glucose pre-infiltration (Fig. 6c). However, glucose did not induce a faster HR response in the hxk1 mutant (Fig. 6d). Rapid HR limits the number of bacteria that can spread to other parts of the plant and, through the induction of early localized cell death, glucose positively regulates ETI by HKX1-related pathways. Overall, glucose enhanced PTI and ETI after exposure to P. syringae pv. tomato DC3000 infection, and this effect was likely mediated by HKX1-related pathways.
Exogenous glucose positively enhances ETI. a Bacterial growth in Col-0 plants exposed to Pto AvrRpm1 or Pto AvrRpt2 after pre-infiltration with glucose. b Bacterial growth in hxk1 plants treated as described in a. c HR in Col-0 leaves exposed to Pto AvrRpm1, Pto AvrRpt2, or MgCl2 (control) after pre-infiltration with glucose or H2O. d HR in hxk1 leaves treated as described in c. Error bars represent the standard error of the mean (n = 3). The asterisk indicates a statistically significant difference (P < 0.05, Student’s t-test). Similar results were obtained from three independent experiments
Discussion
Exogenous sugar supplementation was previously shown to impact bacterial growth [35]. In this study, glucose supplementation suppressed bacterial growth in vitro in a largely dose-dependent manner Additional file 1: Fig. S3, consistent with previous research [36]. Low concentrations of glucose can enter bacterial cells and activate specific pathways that stop or decrease bacterial growth. High glucose concentrations may inhibit bacterial growth through osmotic pressure. Here, when exogenous glucose was added to bacterial growth media, the glucose concentration changed over time. As glucose concentrations within bacterial cells increased, the osmotic pressure within bacterial cells reduced with respect to the outside environment. Under these circumstances, glucose can be transported by carrier proteins and can then activate cellular pathways to slow bacterial growth. However, when the concentration of glucose outside the bacterial cells is too high, the bacteria experience osmotic stress. This results in dehydration, which also suppresses bacterial growth. It is possible that suppression of bacterial growth directly activates related glucose pathways in the absence of osmotic pressure. Additional research is required to further elucidate the effects of glucose on bacterial growth.
As well as direct inhibition of bacterial growth by glucose (Additional file 1: Fig. S3), glucose affects bacteria via stimulation of plant responses via HKX1-related pathways. Leaf infiltration with glucose prior to bacterial exposure reduced disease symptoms and bacterial growth in WT Arabidopsis (Fig. 4). Initially, this effect was attributed to direct inhibition of bacterial growth by glucose. However, glucose induced callose deposition and earlier PR1 accumulationin plants (Fig. 5), indicating that additional pathways may be involved in the reduced disease phenotype. The impact of glucose exposure prior to infection was investigated with respect to growth of Pto AvrRpm1 and Pto AvrRpt2 and in a hypersensitive response assay (Fig. 6). The enhanced disease resistance observed in WT plants pre-infiltrated with glucose was not apparent in hxk1 mutant plants, further indicating that this phenomenon was not due primarily to the direct effects of glucose on bacterial cells. Taken together, these results indicate that glucose may activate HXK1-related pathways involved in mediating plant immune responses.
Based on our observations, we propose that HKX1 may be involved in several events simulated by glucose during the ETI response. The hxk1 mutant would be expected to block the effect of glucose in ETI, because bacterial growth was similar with and without glucose upon Pto AvrRpt2 infiltration (Fig. 4b). However, faster HR also appeared in hxk1 pre-infiltrated with glucose (Fig. 6d). Pto AvrRpt2 appears to be more glucose sensitive than Pto AvrRpm1 (Fig. 6a) which may explain why pre-infiltration still has an effect on HR in the hxk1 mutant.
Our results indicate that HXK1 plays an important role in mediating the effects of glucose on plant immunity. HXK1 is active in plant immunity in both PTI and ETI, and also serves as a kinase that can phosphorylate glucose to glucose-6-phosphate. Absence of HXK1 in the hxk1 mutant background led to higher bacterial growth, reduced callose deposition, and a delay in PR1 accumulation during PTI.
Glucose is ubiquitous in plant cells and is a good candidate as a signaling intermediary in plant immune responses. This study investigated the effects of glucose on plant defences. Exogenous glucose successfully reduced bacterial growth and disease symptoms. Low concentrations of exogenous glucose positively enhanced plant immunity via the PTI and ETI mechanisms. Glucose enhanced callose deposition, stimulated gene expression, and led to earlier PR1 accumulation, indicating involvement in the PTI pathway. Glucose also induced earlier cell death to prevent bacterial growth and earlier HR was observed. The effects of glucose on WT immune responses to infection were not observed in a hxk1 mutant, indicating that exogenous glucose plays a role in plant immunity through HXK1-mediated pathways.
Change history
28 May 2023
Missing funding information has been added.
References
Karve A, Rauh BL, Xia X, Kandasamy M, Meagher RB, Sheen J, Moore Bd (2008) Expression and evolutionary features of the hexokinase gene family in Arabidopsis. Planta 228:411–425
Moore B, Zhou L, Rolland F, Hall Q, Cheng WH, Liu YX, Hwang I, Jones T, Sheen J (2003) Role of the Arabidopsis glucose sensor HXK1 in nutrient, light, and hormonal signaling. Science 300:332–336
Zhou L, Jang JC, Jones TL, Sheen J (1998) Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc Natl Acad Sci USA 95:10294–10299
Sarowar S, Lee JY, Ahn ER, Pai HS (2008) A role of hexokinases in plant resistance to oxidative stress and pathogen infection. J Plant Biol 51:341–346
Jang JC, León P, Zhou L, Sheen J (1997) Hexokinase as a sugar sensor in higher plants. Plant Cell 9:5–19
Jones JDG, Dangl JL (2006) The plant immune system. Nature 444:323–329
Zipfel C (2009) Early molecular events in PAMP-triggered immunity. Curr Opin Plant Biol 12:414–420
Gómez-Gómez L, Boller T (2000) FLS2: An LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell 5:1003–1011
Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JDG, Boller T, Felix G (2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts agrobacterium-mediated transformation. Cell 125:749–760
Chinchilla D, Zipfel C, Robatzek S, Kemmerling B, Nürnberger T, Jones JDG, Boller T (2007) A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448:497–500
Heese A, Hann DR, Gimenez-Ibanez S, Jones AME, He K, Li J, Rathjen JP (2007) The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proc Natl Acad Sci USA 104:12217–12222
Boller T, Felix G (2009) A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol 60:379–406
Gao QM, Zhu S, Kachroo P, Kachroo A (2015) Signal regulators of systemic acquired resistance. Front Plant Sci 6:228
Xin XF, He SY (2013) Pseudomonas syringae pv. tomato DC3000: A Model Pathogen for Probing Disease Susceptibility and Hormone Signaling in Plants. Annu Rev Phytopathol 51:473–498
Dodds PN, Lawrence GJ, Catanzariti AM, Teh T, Wang CIA, Ayliffe MA, Ellis JG (2006) Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci USA 103:8888–8893
Krasileva KV, Dahlbeck D, Staskawicz BJ (2010) Activation of an Arabidopsis resistance protein is specified by the in planta association of its leucine-rich repeat domain with the cognate oomycete effector. Plant Cell 22:2444–2458
Mackey D, Belkhadir Y, Alonso JM, Ecker JR, Dangl JL (2003) Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and moculates RPS2-mediated resistance. Cell 112:379–389
Mackey D, Holt BF III, Wiig A, Dangl JL (2002) RIN4 interacts with Pseudomonas syringae Type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108:743–754
Chisholm ST, Coakerm G, Day B, Staskawicz BJ (2006) Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124:803–814
Axtell MJ, Staskawicz BJ (2003) Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112:369–377
Boyes D, Nam J, Dangl JL (1998) The Arabidopsis thaliana RPM1 disease resistance gene product is a peripheral plasma membrane protein that is degraded. Proc Natl Acad Sci USA 95:15849–15854
Liu J, Elmore JM, Lin ZD, Coaker G (2012) A receptor-like cytoplasmic kinase phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor. Cell Host Microbe 9:137–146
Chisholm ST, Dahlbeck D, Krishnamurthy N, Day B, Sjolander K, Staskawicz BJ (2005) Molecular characterization of proteolytic cleavage sites of the Pseudomonas syringae effector AvrRpt2. Proc Natl Acad Sci USA 102:2087–2092
Axtell MJ, Chisholm ST, Dahlbeck D, Staskawicz BJ (2003) Genetic and molecular evidence that the Pseudomonas syringae type III effector protein AvrRpt2 is a cysteine protease. Mol Microbiol 49:1537–1546
Uddin MN, Akhter S, Chakraborty R, Baek JH, Cha JY, Kang PSJ, H, Kim WY, Lee SY, Mackey D, Kim, MG, (2017) SDE5, a putative RNA export protein, participates in plant innate immunity through a flagellin-dependent signaling pathway in Arabidopsis. Sci Rep 7:1–11
Kim MG, Cunha LD, McFall AJ, Belkhadir Y, DebRoy S, Dangl JL, Mackey D (2005) Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis. Cell 121:749–759
Buell CR, Joardar V, Lindeberg M, Selengut J, Paulsen IT, Gwinn ML, Dodson RJ, Deboy DAS, Kolonay JF, Madupu R, Daugherty S, Brinkac L, Mj B, Haft DH, Nelson WC, Davidsen T, Zafar N, Zhou L, Liu J, Yuan Q, Khouri H, Fedorova N, Tran B, Russell D, Berry K, Utterback T, Aken SEV, Feldblyum TV, D’Ascenzo M, Deng WL, Ramos AR, Alfano JR, Cartinhour S, Chatterjee AK, Delaney TP, Lazarowitz SG, Martin GB, Schneider DJ, TangCollmer A (2003) The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad Sci USA 100:10181–10186
Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller T, Ausubel FM, Sheen J (2002) Map kinase signalling cascade in Arabidopsis innate immunity. Nature 415:977–983
Hauck P, Thilmony R, He SY (2003) A Pseudomonas syringae type III effector suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Proc Natl Acad Sci USA 100:8577–8582
Bestwick CS, Bennett MH, Mansfield JW (1995) Hrp mutant of Pseudomonas syringae pv phaseolicola induces cell wall alterations but not membrane damage leading to the hypersensitive reaction in lettuce. Plant Physiol 108:503–516
Nowicki M, Nowakowska M, Kłosińska U, Golik P, Kozik EU, Lichocka M (2012) A simple dual stain for detailed investigations of plant-fungal pathogen interactions. Veg Crop Res Bull 77:61–74
Ham JH, Kim MG, Lee SY, Mackey D (2007) Layered basal defenses underlie non-host resistance of Arabidopsis to Pseudomonas syringae pv. phaseolicola. Plant J 51:604–616
Ray SK, Macoy DM, Kim WY, Lee SY, Kim MG (2019) Role of RIN4 in regulating PAMP-triggered immunity and effector-triggered immunity: current status and future perspectives. Mol Cells 42:503
Rivière MP, Marais A, Ponchet M, Willats W, Galiana E (2008) Silencing of acidic pathogenesis-related PR-1 genes increases extracellular β-(1→3)-glucanase activity at the onset of tobacco defence reactions. J Exp Bot 59:1225–1239
Olivares-Marin IK, González-Hernández JC, Regalado-Gonzalez C, Madrigal-Perez LA (2018) Saccharomyces cerevisiae exponential growth kinetics in batch culture to analyze respiratory and fermentative metabolism. J Vis Exp 139:1–10
Lu J, Carter DA, Turnbull L, Rosendale D, Hedderley D, Stephens J, Gannabathula S, Steinhorn G, Schlothauer RC, Whitchurch CB, Harry EJ (2013) The effect of New Zealand Kanuka, Manuka and clover honeys on bacterial growth dynamics and cellular morphology varies according to the species. PLoS ONE 8:e55898
Funding
This work was supported by grants from National Research Foundation of Korea (project no. NRF-2020R1I1A2073610) and by Next-Generation BioGreen21 Program (SSAC: PJ01326902) Rural Development Administration, Republic of Korea.
Author information
Authors and Affiliations
Contributions
WJ, SU, RC, JYC and MGK wrote the manuscript with input from other authors. RC, SU, DMM, SOP, DTVN, HUK and GRR performed experiments. WYK and MGK edited the paper, gave support and conceptual advice. All authors discussed the contents and agreed on the contents of the paper and post no conflicting interest. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Additional file 1: Figure S1.
HXK1 is not involved in RPT2-dependent suppression of Pto AvrRpt2. A. Bacterial accumulation in Col-0 and hxk1 after inoculation with 2 × 105 CFU/ml of Pto AvrRpt2. Error bars represent the standard error of the mean (n = 3). B. Ion leakage assay in hxk1 and WT leaves infiltrated with Pto AvrRpt2 or MgCl2 (control). C. Speed of HR in hxk1 and WT infiltrated with Pto AvrRpt2 or MgCl2 (control). Experiments were repeated three times with similar results. Figure S2. High concentrations of glucose damaged plants. A. Mature leaves of Col-0 and Ler plants infiltrated with 0, 2.5, 5, 7.5, and 10% glucose (glc) B. Arabidopsis Col-0 and Ler seedlings were grown at MS media containing 0%, 1.5% and 3% glucose. Experiments were conducted three times. Figure S3. Exogenous glucose suppressed bacterial growth in vitro. Growth of P. syringae strains Pto, Pto AvrRpm1, and Pto AvrRpt2 in KB liquid media supplemented with different concentrations of glucose (glc) and 2× 108 CFU/ml of bacteria . Bacterial growth was measured at approximately 16 h after treatment.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Jing, W., Uddin, S., Chakraborty, R. et al. Molecular characterization of HEXOKINASE1 in plant innate immunity. Appl Biol Chem 63, 76 (2020). https://doi.org/10.1186/s13765-020-00560-8
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13765-020-00560-8